Top » Catalog » I2 » FGC8393

$18.00

FGC8393
[FGC8393]

FGC8393
hg38 Position: ChrY:14100214..14100214
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: I2a
Comments: Below L161.1 > L1498 > S2742
Forward Primer: FGC8393_F ACAACATGCTGACCTACACTGAG
Reverse Primer: FGC8393_R CCTCTCCTGCCTTCCCTTAG
Reviews

Customers who bought this product also purchased
CTS10228
CTS10228
Y14605
Y14605
Y45481
Y45481
L161.1
L161.1
Y3734
Y3734
A2293
A2293
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L42
$18.00
Haplogroup Info
Other products
Currencies