Top » Catalog » I2 » A2239

$18.00

A2239
[A2239]

A2239
hg38 Position: ChrY:7758523..7758523
Ancestral: G
Derived: A
Reference: Richard Gillespie (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Below L126 > S7753/Y4171 > Y4751 > Y4750 > A824
Forward Primer: A2239_F TTGGCCCCCGAAGTAGTC
Reverse Primer: A2239_R CACATGGGCTCTTTGCTCTC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A11616
A11616
A11612
A11612
A824
A824
L126
L126
Y11858
Y11858
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies