Top » Catalog » I2 » CTS8511

$18.00

CTS8511
[CTS8511]

CTS8511
hg38 Position: ChrY:15949038..15949038
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a2a1c2a (no listed)
Comments: Extracted from 1000 genomes data. Aka ZS14
Forward Primer: PF5191v2_F AGAGACTAGAACACATTATAGCTGATGTG
Reverse Primer: PF5191v2_R GCTTTGAGAAATATCTCCTTTCTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies