Top » Catalog » I2 » A2293

$18.00

A2293
[A2293]

A2293
hg38 Position: ChrY:13836005..13836005
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Below L1498
Forward Primer: A2293_F ATGCAGACAACCAGTGGTTC
Reverse Primer: A2293_R AAAGTGATGCAGGAGAAAACAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies