Top » Catalog » I2 » A2293

$18.00

A2293
[A2293]

A2293
hg38 Position: ChrY:13836005..13836005
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Below L1498
Forward Primer: A2293_F ATGCAGACAACCAGTGGTTC
Reverse Primer: A2293_R AAAGTGATGCAGGAGAAAACAAC
Reviews

Customers who bought this product also purchased
CTS10228
CTS10228
Y14605
Y14605
Y45481
Y45481
L161.1
L161.1
Y3734
Y3734
FGC8393
FGC8393
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies