Top » Catalog » I2 » A2329

$18.00

A2329
[A2329]

A2329
hg38 Position: ChrY:15550931..15550931
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1b1a
Comments: Downstream S2742
Forward Primer: A2329_F GATGAAAGATAGACATATAGATGGAACAC
Reverse Primer: A2329_R TTAAAGCACCTCTGAAAATGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies