Top » Catalog » I2 » A2338

$18.00

A2338
[A2338]

A2338
hg38 Position: ChrY:3034798..3034798
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Below L1498 > S2742
Forward Primer: A2338_F CACTGCCACTGAGAGTGATCTG
Reverse Primer: A2338_R GGAGATCCAAGAGCTGTGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies