Top » Catalog » I2 » A2423

$18.00

A2423
[A2423]

A2423
hg38 Position: ChrY:17128713..17128713
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1b2a1a1 (not listed)
Comments: Below S17250 > Z16971
Forward Primer: A2423_F GTCTTGAAATACTGTGCCCTGG
Reverse Primer: A2423_R TGAAGCATGATATCCCACAATTTAC
Reviews

Customers who bought this product also purchased
A5874
A5874
Y5596
Y5596
A815
A815
L161
L161
FGC7126
FGC7126
A356
A356
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies