Top » Catalog » I2 » A2512

$18.00

A2512
[A2512]

A2512
hg38 Position: ChrY:11047364..11047364
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Approx. CTS10228
Forward Primer: A2512_F TTTGTAGTGGGGAAAGACACG
Reverse Primer: A2512_R CCCTCCCTCTCCTTATGCTC
Reviews

Customers who bought this product also purchased
A10959
A10959
L161.1
L161.1
A7134
A7134
BY76303
BY76303
A20030
A20030
FGC7126
FGC7126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies