Top » Catalog » I2 » A2512

$18.00

A2512
[A2512]

A2512
hg38 Position: ChrY:11047364..11047364
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Approx. CTS10228
Forward Primer: A2512_F TTTGTAGTGGGGAAAGACACG
Reverse Primer: A2512_R CCCTCCCTCTCCTTATGCTC
Reviews

Customers who bought this product also purchased
Y8942
Y8942
Y13498
Y13498
Y125625
Y125625
BY190177
BY190177
A21934
A21934
BY116090
BY116090
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY5314
$18.00
Haplogroup Info
Other products
Currencies