Top » Catalog » I2 » A2512

$18.00

A2512
[A2512]

A2512
hg38 Position: ChrY:11047364..11047364
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Approx. CTS10228
Forward Primer: A2512_F TTTGTAGTGGGGAAAGACACG
Reverse Primer: A2512_R CCCTCCCTCTCCTTATGCTC
Reviews

Customers who bought this product also purchased
B57
B57
SK1241
SK1241
S17250
S17250
CTS10228
CTS10228
I2a-M423 Panel
I2a-M423 Panel
A6106
A6106
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies