Top » Catalog » I2 » A2512

$18.00

A2512
[A2512]

A2512
hg38 Position: ChrY:11047364..11047364
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Approx. CTS10228
Forward Primer: A2512_F TTTGTAGTGGGGAAAGACACG
Reverse Primer: A2512_R CCCTCCCTCTCCTTATGCTC
Reviews

Customers who bought this product also purchased
Y25010
Y25010
CTS5779
CTS5779
Y5598
Y5598
PH3414
PH3414
A16413
A16413
Z17855
Z17855
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies