Top » Catalog » I2 » A23892

$18.00

A23892
[A23892]

A23892
hg38 Position: ChrY:7311632..7311632
Ancestral: C
Derived: T
Reference: Milovan Filimonovic (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A23892_F GGCCCTAGAACCCAATGAC
Reverse Primer: A23892_R GCACAGACAGATGAATCACTTG
Reviews

Customers who bought this product also purchased
BY152820
BY152820
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY172.1
1 x A5914
1 x BY6568
1 x BY7536
$72.00
Haplogroup Info
Other products
Currencies