Top » Catalog » I2 » BY153008

$18.00

BY153008
[BY153008]

BY153008
hg38 Position: ChrY:8808023..8808023
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: Below Z17855 > A16413
Forward Primer: BY153008_F CTATCCCCTTACTCCCTCAAATC
Reverse Primer: BY153008_R GCAAATACTTGTTACCTCTACATTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies