Top » Catalog » I2 » A10230

$18.00

A10230
[A10230]

A10230
hg38 Position: ChrY:20157565..20157565
Ancestral: G
Derived: A
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: L621 > L10228 > S17250 > Y4882
Forward Primer: A10230_F GTTCATGGTCCTGCTCACG
Reverse Primer: A10230_R ACACATCTGAAGGATCAATCTCC
Reviews

Customers who bought this product also purchased
M168
M168
L181
L181
CTS595
CTS595
A12505
A12505
M223
M223
A21222
A21222
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y7190
1 x A7729
1 x DYS452
1 x DYS448
1 x FGC7174
1 x L181
$91.90
Haplogroup Info
Other products
Currencies