Top » Catalog » I2 » A10230

$18.00

A10230
[A10230]

A10230
hg38 Position: ChrY:20157565..20157565
Ancestral: G
Derived: A
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: L621 > L10228 > S17250 > Y4882
Forward Primer: A10230_F GTTCATGGTCCTGCTCACG
Reverse Primer: A10230_R ACACATCTGAAGGATCAATCTCC
Reviews

Customers who bought this product also purchased
M253
M253
CTS10228
CTS10228
P126
P126
L596
L596
M168
M168
L181
L181
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1247
1 x BY5937
1 x BY8346
1 x BY5128
$72.00
Haplogroup Info
Other products
Currencies