Top » Catalog » I2 » A10230

$18.00

A10230
[A10230]

A10230
hg38 Position: ChrY:20157565..20157565
Ancestral: G
Derived: A
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: L621 > L10228 > S17250 > Y4882
Forward Primer: A10230_F GTTCATGGTCCTGCTCACG
Reverse Primer: A10230_R ACACATCTGAAGGATCAATCTCC
Reviews

Customers who bought this product also purchased
Y152112
Y152112
FT14506
FT14506
Y100616
Y100616
Z17855
Z17855
Y4460
Y4460
Y141127
Y141127
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies