Top » Catalog » I2 » A23992

$18.00

A23992
[A23992]

A23992
hg38 Position: ChrY:7908423..7908423
Ancestral: A
Derived: G
Reference: John OGrady (2019)
ISOGG Haplogroup: I2
Comments: Downstream Y14338
Forward Primer: A23992_F TGCTGATAATTTAGTGCTCGTAAAATTG
Reverse Primer: A23992_R GCAGTATTATAAGTGTCAGGATGACAGGAGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC71335
1 x A21007
1 x FGC14714
1 x FGC14715
$72.00
Haplogroup Info
Other products
Currencies