Top » Catalog » I2 » A23994

$18.00

A23994
[A23994]

A23994
hg38 Position: ChrY:13727920..13727920
Ancestral: T
Derived: G
Reference: John OGrady (2019)
ISOGG Haplogroup: I2
Comments: Downstream Y14338
Forward Primer: A23994_F TACTCGGTATATACCCAAAGGACTAAG
Reverse Primer: A23994_R CCCTGGAGCAGGTGAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies