Top » Catalog » I2 » BY97555

$18.00

BY97555
[BY97555]

BY97555
hg38 Position: ChrY:12668555..12668555
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: Below S17250 > PH908
Forward Primer: BY97555_F GGCCCAGAAAGTTGAGACAG
Reverse Primer: BY97555_R GTCCCAACTTTATGGGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies