Top » Catalog » I2 » BY140506

$18.00

BY140506
[BY140506]

BY140506
hg38 Position: ChrY:20585888..20585888
Ancestral: G
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: BY140506_F TCCAACTTCTGGGATTCCTC
Reverse Primer: BY140506_R TTGAGATCCTGCACAGCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies