Top » Catalog » I2 » FT14506

$18.00

FT14506
[FT14506]

FT14506
hg38 Position: ChrY:15387752..15387752
Ancestral: G
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Bellow PH908
Forward Primer: FT14506_F GAGGTCTAGGCCTTGGTGC
Reverse Primer: FT14506_R CTAATAATTGGTCTGCTCAAATGC
Reviews

Customers who bought this product also purchased
CTS10228
CTS10228
S17250
S17250
A5913
A5913
Y51673
Y51673
I2a-M423 Panel
I2a-M423 Panel
Y32084
Y32084
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10732
1 x BY8537
1 x BY6337
1 x A9364
$72.00
Haplogroup Info
Other products
Currencies