Top » Catalog » I2 » BY189748

$18.00

BY189748
[BY189748]

BY189748
hg38 Position: ChrY:6991209..6991209
Ancestral: C
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: Below PH908 > Y189804
Forward Primer: BY189748_F TCCTTTTGACCATGCAGAAATC
Reverse Primer: BY189748_R TCAGAGCTCACATCTAAGAAGAATATCC
Reviews

Customers who bought this product also purchased
FT14506
FT14506
Y52621
Y52621
PH908
PH908
A13912
A13912
S17250
S17250
BY191770
BY191770
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies