Top » Catalog » I2 » BY190991

$18.00

BY190991
[BY190991]

BY190991
hg38 Position: ChrY:14585273..14585273
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: Below PH908 > Y189804
Forward Primer: BY190991_F CAATTGAGTTTAAACAATATTTTGGGG
Reverse Primer: BY190991_R CAGACGTTCTCCACCCTAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies