Top » Catalog » I2 » BY152901

$18.00

BY152901
[BY152901]

BY152901
hg38 Position: ChrY:8533302..8533302
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: .Below Z17855 > A16413 > BY153008
Forward Primer: BY152901_F CCCACACTTTGACTCCCAG
Reverse Primer: BY152901_R GGAAGCCTTTAGTGCAAAAGC
Reviews

Customers who bought this product also purchased
BY154629
BY154629
BY154601
BY154601
BY153660
BY153660
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A7727
1 x A18004
$36.00
Haplogroup Info
Other products
Currencies