Top » Catalog » I2 » BY226161

$18.00

BY226161
[BY226161]

BY226161
hg38 Position: ChrY:22728109..22728109
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: BY226161_F ATGCTGAAGTTCTAGCTTAAAGTGG
Reverse Primer: BY226161_R TCCTGCCTCATTGGAACTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies