Top » Catalog » I2 » FT190522

$18.00

FT190522
[FT190522]

FT190522
hg38 Position: ChrY:12622426..12622426
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: FT190522_F TTCTGCTAGAAAGATTCTAGCATTTATG
Reverse Primer: FT190522_R TTTAAATTTAGCATTGATATTGGACATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies