Top » Catalog » I2 » CTS5779

$18.00

CTS5779
[CTS5779]

CTS5779
hg38 Position: ChrY:14363608..14363608
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2 (not listed)
Comments: Downstream from I-Y5598
Forward Primer: CTS5779_F ATGGGGTAAGCACTTTGGTG
Reverse Primer: CTS5779_R CCCGTTTCATTTTTAACCATC
Reviews

Customers who bought this product also purchased
Y125625
Y125625
A2512
A2512
Y25010
Y25010
B57
B57
Y4460
Y4460
I2a-M423 Panel
I2a-M423 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies