Top » Catalog » I2 » S8201

$18.00

S8201
[S8201]

S8201
hg38 Position: ChrY:2819435..2819435
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2 (not listed)
Comments: Downstream from I-Y4460
Forward Primer: S8201_F CCCCAGTGTCAGTTCCTCAC
Reverse Primer: S8201_R TGCCTGCTGTAAGCACAGTC
Reviews

Customers who bought this product also purchased
Y25010
Y25010
Y125625
Y125625
Y8942
Y8942
Y16810
Y16810
SK1241
SK1241
B57
B57
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11214
1 x A2330
$36.00
Haplogroup Info
Other products
Currencies