Top » Catalog » I2 » Y5598

$18.00

Y5598
[Y5598]

Y5598
hg38 Position: ChrY:19591709..19591709
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2 (not listed)
Comments: Downstream from I-Y3118
Forward Primer: Y5598_F TTGAGCACTGCTTATTGTGTTC
Reverse Primer: Y5598_R TGCTGAAGTTCCCTGCAAAG
Reviews

Customers who bought this product also purchased
BY94806
BY94806
Y125625
Y125625
A2512
A2512
Y25010
Y25010
B57
B57
Y4460
Y4460
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY5314
1 x BY6705
$36.00
Haplogroup Info
Other products
Currencies