Top » Catalog » I2 » Y6651

$18.00

Y6651
[Y6651]

Y6651
hg38 Position: ChrY:21630233..21630233
Ancestral: A
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: I2
Comments: Downstream from I-A356
Forward Primer: Y6651_F TTTTGAATGTTGCCAAGGATG
Reverse Primer: Y6651_R AACCTTGGAGACAGAGGTTGTG
Reviews

Customers who bought this product also purchased
YP206
YP206
FGC7126
FGC7126
A356
A356
L161.1
L161.1
Z16971
Z16971
I2a-M423 Panel
I2a-M423 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A5913
1 x BY16408
1 x Y4750
$54.00
Haplogroup Info
Other products
Currencies