Top » Catalog » I2 » A5858

$18.00

A5858
[A5858]

A5858
hg38 Position: ChrY:12189340..12189340
Ancestral: G
Derived: A
Reference: Richard Gillespie (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Downstream from Y4750 > A824
Forward Primer: A5858_F GCAGTAGGATATCGTGGGTGAC
Reverse Primer: A5858_R CAGGGTGCTGATTGGTGTG
Reviews

Customers who bought this product also purchased
A5861
A5861
A5860
A5860
A5859
A5859
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies