Top » Catalog » I2 » A5859

$18.00

A5859
[A5859]

A5859
hg38 Position: ChrY:21606800..21606800
Ancestral: G
Derived: A
Reference: Richard Gillespie (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Downstream from Y4750 > A824
Forward Primer: A5859_F GTTGCTTGCACATTGGAGC
Reverse Primer: A5859_R AAAGCAAGATCAATGGAGCAG
Reviews

Customers who bought this product also purchased
A5860
A5860
A5858
A5858
A5861
A5861
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies