Top » Catalog » I2 » A5860

$18.00

A5860
[A5860]

A5860
hg38 Position: ChrY:12896929..12896929
Ancestral: T
Derived: C
Reference: Richard Gillespie (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Downstream from Y4750 > A824
Forward Primer: A5860_F TTTGCCCCTAAACATCAAGG
Reverse Primer: A5860_R AGGTGGCATGTTTGAGAAGC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A11616
A11616
A11612
A11612
A824
A824
Y11858
Y11858
L126
L126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies