Top » Catalog » I2 » A5860

$18.00

A5860
[A5860]

A5860
hg38 Position: ChrY:12896929..12896929
Ancestral: T
Derived: C
Reference: Richard Gillespie (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Downstream from Y4750 > A824
Forward Primer: A5860_F TTTGCCCCTAAACATCAAGG
Reverse Primer: A5860_R AGGTGGCATGTTTGAGAAGC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A11616
A11616
A824
A824
Y11858
Y11858
L126
L126
I2a-M284 Panel
I2a-M284 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies