Top » Catalog » I2 » A5874

$18.00

A5874
[A5874]

A5874
hg38 Position: ChrY:2868486..2868486
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250 > A5875
Forward Primer: A5874_F TCTGGCAAGTTGTTCTGTGG
Reverse Primer: A5874_R AAAAATCAGGTCAGGCATGG
Reviews

Customers who bought this product also purchased
Y15928
Y15928
A1150
A1150
Y144303
Y144303
A22312
A22312
YP206
YP206
FGC7156
FGC7156
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies