Top » Catalog » I2 » A5874

$18.00

A5874
[A5874]

A5874
hg38 Position: ChrY:2868486..2868486
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250 > A5875
Forward Primer: A5874_F TCTGGCAAGTTGTTCTGTGG
Reverse Primer: A5874_R AAAAATCAGGTCAGGCATGG
Reviews

Customers who bought this product also purchased
A14798
A14798
PH908
PH908
Y4460
Y4460
A5875
A5875
I2a-M423 Panel
I2a-M423 Panel
Y5596
Y5596
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies