Top » Catalog » I2 » A5874

$18.00

A5874
[A5874]

A5874
hg38 Position: ChrY:2868486..2868486
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250 > A5875
Forward Primer: A5874_F TCTGGCAAGTTGTTCTGTGG
Reverse Primer: A5874_R AAAAATCAGGTCAGGCATGG
Reviews

Customers who bought this product also purchased
A14798
A14798
Y4460
Y4460
A5875
A5875
PH908
PH908
Y4882
Y4882
A815
A815
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies