Top » Catalog » I2 » A5875

$18.00

A5875
[A5875]

A5875
hg38 Position: ChrY:13305957..13305957
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250 > A815
Forward Primer: A5875_F TTAATAGAGAGGGTACTTTGGTTTTC
Reverse Primer: A5875_R GCACCCACTCAACATTTCTG
Reviews

Customers who bought this product also purchased
A14798
A14798
CTS10228
CTS10228
L161.1
L161.1
S17250
S17250
A815
A815
I2a-M423 Panel
I2a-M423 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies