Top » Catalog » I2 » A5875

$18.00

A5875
[A5875]

A5875
hg38 Position: ChrY:13305957..13305957
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250 > A815
Forward Primer: A5875_F TTAATAGAGAGGGTACTTTGGTTTTC
Reverse Primer: A5875_R GCACCCACTCAACATTTCTG
Reviews

Customers who bought this product also purchased
A14798
A14798
CTS10228
CTS10228
L161.1
L161.1
A5874
A5874
S17250
S17250
A815
A815
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies