Top » Catalog » I2 » A5875

$18.00

A5875
[A5875]

A5875
hg38 Position: ChrY:13305957..13305957
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250 > A815
Forward Primer: A5875_F TTAATAGAGAGGGTACTTTGGTTTTC
Reverse Primer: A5875_R GCACCCACTCAACATTTCTG
Reviews

Customers who bought this product also purchased
Z17855
Z17855
A13909
A13909
A5877
A5877
YP206
YP206
FGC7156
FGC7156
Y32084
Y32084
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies