Top » Catalog » I2 » A5876

$18.00

A5876
[A5876]

A5876
hg38 Position: ChrY:16273903..16273903
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250 > A5874
Forward Primer: A5876_F CTCATCAAATGGCCAAATCC
Reverse Primer: A5876_R ATCCAGGTGCTGTGAAGATG
Reviews

Customers who bought this product also purchased
A21278
A21278
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1150
1 x BY97805
1 x A9403
1 x A18006
1 x L1285
1 x A17067
$108.00
Haplogroup Info
Other products
Currencies