Top » Catalog » I2 » A5913

$18.00

A5913
[A5913]

A5913
hg38 Position: ChrY:6874729..6874729
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Downstream S17250 (Din South)
Forward Primer: A5913_F GTTCAGAAAAGCGCCAAAAG
Reverse Primer: A5913_R AAAGCATGCGTTTAATAGATCAC
Reviews

Customers who bought this product also purchased
Y56203
Y56203
Y5596
Y5596
Y4882
Y4882
S2679
S2679
P126
P126
S2490
S2490
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies