Top » Catalog » I2 » A5913

$18.00

A5913
[A5913]

A5913
hg38 Position: ChrY:6874729..6874729
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Downstream S17250 (Din South)
Forward Primer: A5913_F GTTCAGAAAAGCGCCAAAAG
Reverse Primer: A5913_R AAAGCATGCGTTTAATAGATCAC
Reviews

Customers who bought this product also purchased
L161.1
L161.1
PH3310
PH3310
I2a-M423 Panel
I2a-M423 Panel
A356
A356
Y4460
Y4460
S17250
S17250
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies