Top » Catalog » I2 » A5914

$18.00

A5914
[A5914]

A5914
hg38 Position: ChrY:9008677..9008677
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Downstream S17250 (Din South)
Forward Primer: A5914_F TCTCCATGGGATCTGATTCTTC
Reverse Primer: A5914_R TGTAACACTTGCCAGAACTCAAAC
Reviews

Customers who bought this product also purchased
A14301
A14301
L161.1
L161.1
Y5596
Y5596
I2a-M423 Panel
I2a-M423 Panel
Y4882
Y4882
Y4460
Y4460
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies