Top » Catalog » I2 » A5914

$18.00

A5914
[A5914]

A5914
hg38 Position: ChrY:9008677..9008677
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Downstream S17250 (Din South)
Forward Primer: A5914_F TCTCCATGGGATCTGATTCTTC
Reverse Primer: A5914_R TGTAACACTTGCCAGAACTCAAAC
Reviews

Customers who bought this product also purchased
A14301
A14301
Y4460
Y4460
YP206
YP206
S17250
S17250
Y3548
Y3548
CTS10228
CTS10228
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies