Top » Catalog » I2 » A6105

$18.00

A6105
[A6105]

A6105
hg38 Position: ChrY:19673765..19673765
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1b2a1b
Comments: Downstream Y4460
Forward Primer: A6105_F TGATGGCAGATGGATGTCTC
Reverse Primer: A6105_R TCAGGGAATGGTGTGACTTG
Reviews

Customers who bought this product also purchased
A6106
A6106
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies