Top » Catalog » I2 » A6106

$18.00

A6106
[A6106]

A6106
hg38 Position: ChrY:20507464..20507464
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1b2a1b
Comments: Downstream Y4460
Forward Primer: A6106_F GTGTCCTGGTGTCTTTTGGAG
Reverse Primer: A6106_R TTTTTGATCTTAATCTCAATTTCAGC
Reviews

Customers who bought this product also purchased
SK1241
SK1241
B57
B57
A2512
A2512
I2a-M423 Panel
I2a-M423 Panel
Y3118
Y3118
Y4460
Y4460
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies