Top » Catalog » I2 » A6106

$18.00

A6106
[A6106]

A6106
hg38 Position: ChrY:20507464..20507464
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1b2a1b
Comments: Downstream Y4460
Forward Primer: A6106_F GTGTCCTGGTGTCTTTTGGAG
Reverse Primer: A6106_R TTTTTGATCTTAATCTCAATTTCAGC
Reviews

Customers who bought this product also purchased
Y16810
Y16810
SK1241
SK1241
B57
B57
A2512
A2512
CTS10228
CTS10228
Y13498
Y13498
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies