Top » Catalog » I2 » Y4142

$18.00

Y4142
[Y4142]

Y4142
hg38 Position: ChrY:8256713..8256713
Ancestral: A
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: I2
Comments: Downstream from S7753/Y4171/FGC20048 and upstream from Y4751/FGC20065.
Forward Primer: Y4142_F GCCTATGGATGAAAACCCAG
Reverse Primer: Y4142_R TAGGCTGGAGTGCATTGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies