Top » Catalog » I2 » A6696

$18.00

A6696
[A6696]

A6696
hg38 Position: ChrY:13577794..13577794
Ancestral: G
Derived: C
Reference: Pat Hemphill (2015)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A6696_F ACCTTACCCCAGCCAGAATG
Reverse Primer: A6696_R TGCGACAGATCTATTGTGTGTG
Reviews

Customers who bought this product also purchased
Y9267
Y9267
Y8601
Y8601
A6699
A6699
Y11668
Y11668
A6698
A6698
Y10704
Y10704
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies