Top » Catalog » I2 » A6696

$18.00

A6696
[A6696]

A6696
hg38 Position: ChrY:13577794..13577794
Ancestral: G
Derived: C
Reference: Pat Hemphill (2015)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A6696_F ACCTTACCCCAGCCAGAATG
Reverse Primer: A6696_R TGCGACAGATCTATTGTGTGTG
Reviews

Customers who bought this product also purchased
A6698
A6698
Y10704
Y10704
A6697
A6697
Y9269
Y9269
Z21257
Z21257
Y8602
Y8602
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies