Top » Catalog » I2 » A6698

$18.00

A6698
[A6698]

A6698
hg38 Position: ChrY:21455175..21455175
Ancestral: A
Derived: G
Reference: Pat Hemphill (2015)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A6698_F GTTCCAGACTCAAATAAATTCAACG
Reverse Primer: A6698_R CTTGGGCCAGAATCTTAGAACC
Reviews

Customers who bought this product also purchased
Z21257
Z21257
Y8602
Y8602
Y9267
Y9267
Y8601
Y8601
A6699
A6699
Y11668
Y11668
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies