Top » Catalog » I2 » A7110

$18.00

A7110
[A7110]

A7110
hg38 Position: ChrY:21343904..21343904
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1a (not listed)
Comments: Downstream Y15579
Forward Primer: A7110_F CCAGATATTTAGGTTGATGAGAATATGAG
Reverse Primer: A7110_R ATATTAATTACCTCATCTTTCTTATTTAAAAAAG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies