Top » Catalog » I2 » A356

$18.00

A356
[A356]

A356
hg38 Position: ChrY:15447088..15447088
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1a3
Comments: Downstream CTS5966 (Dinaric-South)
Forward Primer: A356_F TTGTCATCAACCTGCCAGAC
Reverse Primer: A356_R AGGCGACTGGTCAGATCTTC
Reviews

Customers who bought this product also purchased
PH908
PH908
A13912
A13912
A5913
A5913
PH3310
PH3310
Y16473
Y16473
A7358
A7358
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies