Top » Catalog » I2 » A356

$18.00

A356
[A356]

A356
hg38 Position: ChrY:15447088..15447088
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1a3
Comments: Downstream CTS5966 (Dinaric-South)
Forward Primer: A356_F TTGTCATCAACCTGCCAGAC
Reverse Primer: A356_R AGGCGACTGGTCAGATCTTC
Reviews

Customers who bought this product also purchased
Y56203
Y56203
M438
M438
Y32084
Y32084
M96
M96
S2679
S2679
P126
P126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies