Top » Catalog » I2 » A7318

$18.00

A7318
[A7318]

A7318
hg38 Position: ChrY:8498675..8498675
Ancestral: A
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: I2a
Comments: Aka Y17665. Downstream of A1328
Forward Primer: A7318_F CACATTACTGCACCCAGCAC
Reverse Primer: A7318_R CACTCAGAAGCTGGTCAAAGG
Reviews

Customers who bought this product also purchased
A12505
A12505
Y5596
Y5596
L161.1
L161.1
PH908
PH908
A1328
A1328
Y4882
Y4882
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies