Top » Catalog » I2 » A7318

$18.00

A7318
[A7318]

A7318
hg38 Position: ChrY:8498675..8498675
Ancestral: A
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: I2a
Comments: Aka Y17665. Downstream of A1328
Forward Primer: A7318_F CACATTACTGCACCCAGCAC
Reverse Primer: A7318_R CACTCAGAAGCTGGTCAAAGG
Reviews

Customers who bought this product also purchased
A12505
A12505
Y5596
Y5596
L161.1
L161.1
A811
A811
I2a-M423 Panel
I2a-M423 Panel
Z16971
Z16971
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies