Top » Catalog » I2 » A7390

$18.00

A7390
[A7390]

A7390
hg38 Position: ChrY:12260183..12260183
Ancestral: G
Derived: A
Reference: Richard Gillespie (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y4750 Y11858 Y11857
Forward Primer: A7390_F CCTTATTTAAGGAACTTAACTGAATCTCTAAG
Reverse Primer: A7390_R CCCCCCACTGCTCTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies