Top » Catalog » I2 » A7395

$18.00

A7395
[A7395]

A7395
hg38 Position: ChrY:7359261..7359261
Ancestral: G
Derived: A
Reference: Richard Gillespie (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y4750
Forward Primer: A7395_F CTTGCCACTTTAGCCTCCTG
Reverse Primer: A7395_R ACTGTCTGCCCCGTTAGTG
Reviews

Customers who bought this product also purchased
A7396
A7396
Y11858
Y11858
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies