Top » Catalog » I2 » A7406

$18.00

A7406
[A7406]

A7406
hg38 Position: ChrY:13896257..13896257
Ancestral: C
Derived: T
Reference: Connie McKenzie (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y4750
Forward Primer: A7406_F TCACTGGAGGTATCTTGGCC
Reverse Primer: A7406_R TGGGATTGTAAAGTAAGAATAGATTTTG
Reviews

Customers who bought this product also purchased
L126
L126
A7389
A7389
I2a-M284 Panel
I2a-M284 Panel
A824
A824
Y17214
Y17214
Y11857
Y11857
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies