Top » Catalog » I2 » A7407

$18.00

A7407
[A7407]

A7407
hg38 Position: ChrY:14439074..14439074
Ancestral: A
Derived: G
Reference: Connie McKenzie (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y4750
Forward Primer: A7407_F TCTAAGCCAGGCTAGTCCTTC
Reverse Primer: A7407_R TGGGAAAGGCAGATGAACAC
Reviews

Customers who bought this product also purchased
A7406
A7406
YFS107255
YFS107255
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies